BW ( continuing on pg 96 )
What is the complementary DNA strand of
GAGACCTTAACAGTCAATGG?
( A=T and C=G )
Write your answer on a white board and in your notebooks.
"We keep moving forward, opening new doors, and doing new things, because we're curious and curiosity keeps leading us down new paths." Walt Disney "The important thing is not to stop questioning. Curiosity has its own reason for existing." Albert Einstein
No comments:
Post a Comment