Secret of Photo 51

BW (pg 99)
Who is Rosalind Franklin and why should you know her name?

Today we will watch "The Secret of Photo 51"

Your answers to the video sheet should go on pgs 100 & 101.

BW pg 99
What do A, C, T & G stand for?

Peer Review

BW (continue on page 99)

What does peer review mean?

On Canvas join a group and submit DNA Model Report. 

DNA model Argumentation session and report writing (BW pg 99)

BW (on pg 99)
Write out a legend for all of the parts of your DNA model.

You will have 20 minutes to finish up your argumentation board

Then you will complete the argumentation session.  One person (chosen at random) will stay with your board, the rest of the group will go around to other groups, look at the questions below for ideas of what to talk about with each group.

Once the argumentation session is complete, you will have time to revise and then begin your report.

Click here for the peer review guide to also help with writing your report

DNA Argumentation Board

BW ( continue on pg 96)

What do you have to include on your argument board after you develop the model?  Click here  
Click on the picture below for help with your argumentation board.

DNA Model continued

 BW ( continuing on pg 96 )

What is the complementary DNA strand  of 

GAGACCTTAACAGTCAATGG?

( A=T  and C=G )

Write your answer on a white board and in your notebooks. 

BW (continuing on pg 96)

What is the complementary  DNA strand of

ACATGGACCATCCA?  

(Hint: Remember Chargraff's Ratios)

96-98 DNA structure

BW (on pg 96 for the week)

• What are the three parts of a nucleotide?
• What are the four bases in DNA?

Today you will work on your DNA model.  The DNA fact sheet goes on pg 97. Click here for the instructions, you need to complete the investigation proposal on pg 98.  Once your investigation proposal is approved, you will be given a set of pop beads, and you need to make a DNA model from the kit you are given.

91-95 Chargraff's Data & Science notebook

Let's start the "official notebook" for second semester on pg 91 of your science notebook.  

Label pg 91 second semester biology The Chargraff's DNA data activity will go on pgs 92-95

You may go back and finish up the Enzyme lab to turn it in, and then begin working on Chargraff's DNA data.  You will have Friday to work on Chargraff's as well.  We will move onto DNA models next week.

Enzyme Lab

Use the class period today to finish up the enzyme lab.  Remember, the only items needed in the submission are 

• Data table
• Analysis (that includes a graph with a best fit line)
• Conclusion (minimum of 3 paragraphs to get full credit for this section -- Click here for conclusion help)

Pudding Lab

Instant Pudding
How is instant pudding different from traditional cook and serve?  How does this activity relate to enzymes, their function and their importance in biological systems? How does energy play a role in these systems (instant vs cook and serve)?

Click here for directions

Survey and more Enzyme stuff

Please complete the following survey

http://goo.gl/forms/uq0GWijhaI

Click here and here for two activities on independent and dependent variables

We don't have milk to complete the pudding lab, we will do it first thing on Monday afternoon.  

Please make sure that your enzyme lab is completed 
(click here for help in creating the graph digitally)


Use this information to help with your lab:

https://docs.google.com/document/d/1E2Kg7erfh7sLtNpuzF0u06OHCd1cZGmyncM3ORNSnkQ/edit?usp=sharing (Links to an external site.)

For this lab, you will write up JUST THE FOLLOWING:

Remember you only need 

• Data Table/Observations
• Analysis (graph with best fit lines and equations for lines written underneath the graph)
• Conclusion (claim, evidence and reasoning)

CONCLUSION HINTS

And if you aren't done with the Enzyme tutorial, here it is

Enzyme Tutorial

Enzyme information

Click on the following tutorial for more information about enzymes (to help with your analysis and conclusion from the lab)

Enzyme Action

Use this information to help with your lab:

https://docs.google.com/document/d/1E2Kg7erfh7sLtNpuzF0u06OHCd1cZGmyncM3ORNSnkQ/edit?usp=sharing (Links to an external site.)

For this lab, you will write up JUST THE FOLLOWING:

Remember you only need 

• Data Table/Observations
• Analysis (graph with best fit lines and equations for lines written underneath the graph)
• Conclusion (claim, evidence and reasoning)

CONCLUSION HINTS

Pre-test for the spring semester

Pre-test today :)

Please do not guess, I want to know what you know, not how good you can guess answers.

Fill out the bubble sheet with your answers, once that is done, please go to 

https://puhsd.d2sc.com/index.html

Your log on and password are your ID#.  Click on Student-at-a-glance (on the left of the screen).  Click on your name, and then assignments.  Your classes should come up on the middle part of the screen, click on assessments under AP Biology, and then take assessment.  You should be able to enter your answers there. Once complete, click save and then submit.

Enzyme Lab

See lab directions for question, materials, procedures and 

sample data table. Here is the lab:

https://docs.google.com/document/d/1E2Kg7erfh7sLtNpuzF0u06OHCd1cZGmyncM3ORNSnkQ/edit?usp=sharing (Links to an external site.)

For this lab, you will write up JUST THE FOLLOWING:

• Data Table/Observations
• Analysis (graph with best fit lines and equations for lines written underneath the graph)
• Conclusion (claim, evidence and reasoning)

CONCLUSION HINTS