Monday, February 2, 2015

DNA Replication

BW ( page 102)

Remember the potato lab.  You observed catalase causing something to happen.  
  What is catalase?
   What does it do? 
 Click here for the power point.

Friday, January 30, 2015

Secret of Photo 51

BW (pg 99)
Who is Rosalind Franklin and why should you know her name?

Today we will watch "The Secret of Photo 51"

Your answers to the video sheet should go on pgs 100 & 101.

Thursday, January 29, 2015

Wednesday, January 28, 2015

Peer Review

BW (continue on page 99)

What does peer review mean?

On Canvas join a group and submit DNA Model Report. 

Monday, January 26, 2015

DNA model Argumentation session and report writing (BW pg 99)

BW (on pg 99)
Write out a legend for all of the parts of your DNA model.

You will have 20 minutes to finish up your argumentation board


Then you will complete the argumentation session.  One person (chosen at random) will stay with your board, the rest of the group will go around to other groups, look at the questions below for ideas of what to talk about with each group.


Once the argumentation session is complete, you will have time to revise and then begin your report.

Click here for the peer review guide to also help with writing your report



Friday, January 23, 2015

DNA Argumentation Board

BW ( continue on pg 96)

What do you have to include on your argument board after you develop the model?  Click here  
Click on the picture below for help with your argumentation board.

Thursday, January 22, 2015

DNA Model continued

 BW ( continuing on pg 96 )
What is the complementary DNA strand  of 

GAGACCTTAACAGTCAATGG?

( A=T  and C=G )

Write your answer on a white board and in your notebooks. 

Wednesday, January 21, 2015

BW (continuing on pg 96)

What is the complementary  DNA strand of

ACATGGACCATCCA?  

(Hint: Remember Chargraff's Ratios)

Tuesday, January 20, 2015

96-98 DNA structure

BW (on pg 96 for the week)

  • What are the three parts of a nucleotide?
  • What are the four bases in DNA?


Today you will work on your DNA model.  The DNA fact sheet goes on pg 97. Click here for the instructions, you need to complete the investigation proposal on pg 98.  Once your investigation proposal is approved, you will be given a set of pop beads, and you need to make a DNA model from the kit you are given.

Thursday, January 15, 2015

91-95 Chargraff's Data & Science notebook

Let's start the "official notebook" for second semester on pg 91 of your science notebook.  

Label pg 91 second semester biology The Chargraff's DNA data activity will go on pgs 92-95

You may go back and finish up the Enzyme lab to turn it in, and then begin working on Chargraff's DNA data.  You will have Friday to work on Chargraff's as well.  We will move onto DNA models next week.

Wednesday, January 14, 2015

Enzyme Lab

Use the class period today to finish up the enzyme lab.  Remember, the only items needed in the submission are 
  • Data table
  • Analysis (that includes a graph with a best fit line)
  • Conclusion (minimum of 3 paragraphs to get full credit for this section -- Click here for conclusion help)

Monday, January 12, 2015

Pudding Lab

Instant Pudding
How is instant pudding different from traditional cook and serve?  How does this activity relate to enzymes, their function and their importance in biological systems? How does energy play a role in these systems (instant vs cook and serve)?

Click here for directions

Friday, January 9, 2015

Survey and more Enzyme stuff

Please complete the following survey

http://goo.gl/forms/uq0GWijhaI

Click here and here for two activities on independent and dependent variables

We don't have milk to complete the pudding lab, we will do it first thing on Monday afternoon.  

Please make sure that your enzyme lab is completed 
(click here for help in creating the graph digitally)


Use this information to help with your lab:
For this lab, you will write up JUST THE FOLLOWING:
Remember you only need 
  • Data Table/Observations
  • Analysis (graph with best fit lines and equations for lines written underneath the graph)
  • Conclusion (claim, evidence and reasoning)

CONCLUSION HINTS

And if you aren't done with the Enzyme tutorial, here it is

Wednesday, January 7, 2015

Enzyme information

Click on the following tutorial for more information about enzymes (to help with your analysis and conclusion from the lab)

Enzyme Action

Use this information to help with your lab:
For this lab, you will write up JUST THE FOLLOWING:
Remember you only need 
  • Data Table/Observations
  • Analysis (graph with best fit lines and equations for lines written underneath the graph)
  • Conclusion (claim, evidence and reasoning)


Tuesday, January 6, 2015

Pre-test for the spring semester

Pre-test today :)

Please do not guess, I want to know what you know, not how good you can guess answers.

Fill out the bubble sheet with your answers, once that is done, please go to 

https://puhsd.d2sc.com/index.html

Your log on and password are your ID#.  Click on Student-at-a-glance (on the left of the screen).  Click on your name, and then assignments.  Your classes should come up on the middle part of the screen, click on assessments under AP Biology, and then take assessment.  You should be able to enter your answers there. Once complete, click save and then submit.

Monday, January 5, 2015

Enzyme Lab

See lab directions for question, materials, procedures and 
sample data table. Here is the lab:

For this lab, you will write up JUST THE FOLLOWING:
  • Data Table/Observations
  • Analysis (graph with best fit lines and equations for lines written underneath the graph)
  • Conclusion (claim, evidence and reasoning)

Tuesday, December 16, 2014

Winter Break Assignment

Over the break, please share the newsletter with your parents/guardians (click here for a digital copy).
Also, please share the article "Sloths, Moths and Algae . ." and answer the questions on the back.

Thursday, December 11, 2014

Final Review

Click here for a copy of the review.

Make a copy (under the "file" tab) so that you can type directly into the google doc. This is your study guide, the more of it you complete, the easier the final exam will be (it is a week from today)

Wednesday, December 10, 2014

Peer review

We are going to complete the peer review form electronically.  Here are the steps

  1. log into google drive
  2. Click here to open the peer review PDF form
  3. Once it is opened, at the top of the page, click open with and select "DocHub" (if this is the first time you have used this program, you will have to "OK" it for google drive)
  4. The PDF will open in DocHub and you can now add text and fill out the form.
  5. One person from your group needs to share your report with another group (Mrs. Strong will assign groups)
  6. Once you have completed the peer review form, save it in DocHub and then in the top right corner, there is a button to send it to google drive.  Do that and then share it with the author as well as with me.
  7. Once you receive your peer review back, edit the original report and fill out your portion of the peer review, following the same steps for when you edited another group's report. 
  8. When your report is complete submit the report to canvas and share the peer review with me (through google drive)

Monday, December 8, 2014