BW (pg 99)
Who is Rosalind Franklin and why should you know her name?
Today we will watch "The Secret of Photo 51"
Your answers to the video sheet should go on pgs 100 & 101.
"We keep moving forward, opening new doors, and doing new things, because we're curious and curiosity keeps leading us down new paths." Walt Disney "The important thing is not to stop questioning. Curiosity has its own reason for existing." Albert Einstein
Friday, January 30, 2015
Wednesday, January 28, 2015
Peer Review
BW (continue on page 99)
What does peer review mean?
On Canvas join a group and submit DNA Model Report.
What does peer review mean?
On Canvas join a group and submit DNA Model Report.
Monday, January 26, 2015
DNA model Argumentation session and report writing (BW pg 99)
BW (on pg 99)
Write out a legend for all of the parts of your DNA model.
You will have 20 minutes to finish up your argumentation board
Write out a legend for all of the parts of your DNA model.
You will have 20 minutes to finish up your argumentation board
Then you will complete the argumentation session. One person (chosen at random) will stay with your board, the rest of the group will go around to other groups, look at the questions below for ideas of what to talk about with each group.
Once the argumentation session is complete, you will have time to revise and then begin your report.
Click here for the peer review guide to also help with writing your report
Friday, January 23, 2015
DNA Argumentation Board
BW ( continue on pg 96)
What do you have to include on your argument board after you develop the model? Click here
Click on the picture below for help with your argumentation board.
What do you have to include on your argument board after you develop the model? Click here
Click on the picture below for help with your argumentation board.
Thursday, January 22, 2015
DNA Model continued
BW ( continuing on pg 96 )
What is the complementary DNA strand of
GAGACCTTAACAGTCAATGG?
( A=T and C=G )
Write your answer on a white board and in your notebooks.
Wednesday, January 21, 2015
Tuesday, January 20, 2015
96-98 DNA structure
BW (on pg 96 for the week)
Today you will work on your DNA model. The DNA fact sheet goes on pg 97. Click here for the instructions, you need to complete the investigation proposal on pg 98. Once your investigation proposal is approved, you will be given a set of pop beads, and you need to make a DNA model from the kit you are given.
- What are the three parts of a nucleotide?
- What are the four bases in DNA?
Today you will work on your DNA model. The DNA fact sheet goes on pg 97. Click here for the instructions, you need to complete the investigation proposal on pg 98. Once your investigation proposal is approved, you will be given a set of pop beads, and you need to make a DNA model from the kit you are given.
Thursday, January 15, 2015
91-95 Chargraff's Data & Science notebook
Let's start the "official notebook" for second semester on pg 91 of your science notebook.
Label pg 91 second semester biology The Chargraff's DNA data activity will go on pgs 92-95
You may go back and finish up the Enzyme lab to turn it in, and then begin working on Chargraff's DNA data. You will have Friday to work on Chargraff's as well. We will move onto DNA models next week.
Label pg 91 second semester biology The Chargraff's DNA data activity will go on pgs 92-95
You may go back and finish up the Enzyme lab to turn it in, and then begin working on Chargraff's DNA data. You will have Friday to work on Chargraff's as well. We will move onto DNA models next week.
Wednesday, January 14, 2015
Enzyme Lab
Use the class period today to finish up the enzyme lab. Remember, the only items needed in the submission are
- Data table
- Analysis (that includes a graph with a best fit line)
- Conclusion (minimum of 3 paragraphs to get full credit for this section -- Click here for conclusion help)
Monday, January 12, 2015
Pudding Lab
Instant Pudding
How is instant pudding different from traditional cook and serve? How does this activity relate to enzymes, their function and their importance in biological systems? How does energy play a role in these systems (instant vs cook and serve)?
Click here for directions
How is instant pudding different from traditional cook and serve? How does this activity relate to enzymes, their function and their importance in biological systems? How does energy play a role in these systems (instant vs cook and serve)?
Click here for directions
Friday, January 9, 2015
Survey and more Enzyme stuff
Please complete the following survey
http://goo.gl/forms/uq0GWijhaI
Click here and here for two activities on independent and dependent variables
We don't have milk to complete the pudding lab, we will do it first thing on Monday afternoon.
Please make sure that your enzyme lab is completed
(click here for help in creating the graph digitally)
Use this information to help with your lab:
http://goo.gl/forms/uq0GWijhaI
Click here and here for two activities on independent and dependent variables
We don't have milk to complete the pudding lab, we will do it first thing on Monday afternoon.
Please make sure that your enzyme lab is completed
(click here for help in creating the graph digitally)
Use this information to help with your lab:
For this lab, you will write up JUST THE FOLLOWING:
Remember you only need
- Data Table/Observations
- Analysis (graph with best fit lines and equations for lines written underneath the graph)
- Conclusion (claim, evidence and reasoning)
Wednesday, January 7, 2015
Enzyme information
Click on the following tutorial for more information about enzymes (to help with your analysis and conclusion from the lab)
Enzyme Action
Use this information to help with your lab:
Enzyme Action
Use this information to help with your lab:
For this lab, you will write up JUST THE FOLLOWING:
Remember you only need
- Data Table/Observations
- Analysis (graph with best fit lines and equations for lines written underneath the graph)
- Conclusion (claim, evidence and reasoning)
Tuesday, January 6, 2015
Pre-test for the spring semester
Pre-test today :)
Please do not guess, I want to know what you know, not how good you can guess answers.
Fill out the bubble sheet with your answers, once that is done, please go to
https://puhsd.d2sc.com/index.html
Your log on and password are your ID#. Click on Student-at-a-glance (on the left of the screen). Click on your name, and then assignments. Your classes should come up on the middle part of the screen, click on assessments under AP Biology, and then take assessment. You should be able to enter your answers there. Once complete, click save and then submit.
Please do not guess, I want to know what you know, not how good you can guess answers.
Fill out the bubble sheet with your answers, once that is done, please go to
https://puhsd.d2sc.com/index.html
Your log on and password are your ID#. Click on Student-at-a-glance (on the left of the screen). Click on your name, and then assignments. Your classes should come up on the middle part of the screen, click on assessments under AP Biology, and then take assessment. You should be able to enter your answers there. Once complete, click save and then submit.
Monday, January 5, 2015
Enzyme Lab
See lab directions for question, materials, procedures and
sample data table. Here is the lab:
For this lab, you will write up JUST THE FOLLOWING:
- Data Table/Observations
- Analysis (graph with best fit lines and equations for lines written underneath the graph)
- Conclusion (claim, evidence and reasoning)
Subscribe to:
Posts (Atom)




