DNA model Argumentation session and report writing (BW pg 99)

BW (on pg 99)
Write out a legend for all of the parts of your DNA model.

You will have 20 minutes to finish up your argumentation board

Then you will complete the argumentation session.  One person (chosen at random) will stay with your board, the rest of the group will go around to other groups, look at the questions below for ideas of what to talk about with each group.

Once the argumentation session is complete, you will have time to revise and then begin your report.

Click here for the peer review guide to also help with writing your report

DNA Argumentation Board

BW ( continue on pg 96)

What do you have to include on your argument board after you develop the model?  Click here  
Click on the picture below for help with your argumentation board.

DNA Model continued

 BW ( continuing on pg 96 )

What is the complementary DNA strand  of 

GAGACCTTAACAGTCAATGG?

( A=T  and C=G )

Write your answer on a white board and in your notebooks. 

BW (continuing on pg 96)

What is the complementary  DNA strand of

ACATGGACCATCCA?  

(Hint: Remember Chargraff's Ratios)

96-98 DNA structure

BW (on pg 96 for the week)

• What are the three parts of a nucleotide?
• What are the four bases in DNA?

Today you will work on your DNA model.  The DNA fact sheet goes on pg 97. Click here for the instructions, you need to complete the investigation proposal on pg 98.  Once your investigation proposal is approved, you will be given a set of pop beads, and you need to make a DNA model from the kit you are given.

91-95 Chargraff's Data & Science notebook

Let's start the "official notebook" for second semester on pg 91 of your science notebook.  

Label pg 91 second semester biology The Chargraff's DNA data activity will go on pgs 92-95

You may go back and finish up the Enzyme lab to turn it in, and then begin working on Chargraff's DNA data.  You will have Friday to work on Chargraff's as well.  We will move onto DNA models next week.

Enzyme Lab

Use the class period today to finish up the enzyme lab.  Remember, the only items needed in the submission are 

• Data table
• Analysis (that includes a graph with a best fit line)
• Conclusion (minimum of 3 paragraphs to get full credit for this section -- Click here for conclusion help)

Pudding Lab

Instant Pudding
How is instant pudding different from traditional cook and serve?  How does this activity relate to enzymes, their function and their importance in biological systems? How does energy play a role in these systems (instant vs cook and serve)?

Click here for directions

Survey and more Enzyme stuff

Please complete the following survey

http://goo.gl/forms/uq0GWijhaI

Click here and here for two activities on independent and dependent variables

We don't have milk to complete the pudding lab, we will do it first thing on Monday afternoon.  

Please make sure that your enzyme lab is completed 
(click here for help in creating the graph digitally)


Use this information to help with your lab:

https://docs.google.com/document/d/1E2Kg7erfh7sLtNpuzF0u06OHCd1cZGmyncM3ORNSnkQ/edit?usp=sharing (Links to an external site.)

For this lab, you will write up JUST THE FOLLOWING:

Remember you only need 

• Data Table/Observations
• Analysis (graph with best fit lines and equations for lines written underneath the graph)
• Conclusion (claim, evidence and reasoning)

CONCLUSION HINTS

And if you aren't done with the Enzyme tutorial, here it is

Enzyme Tutorial

Enzyme information

Click on the following tutorial for more information about enzymes (to help with your analysis and conclusion from the lab)

Enzyme Action

Use this information to help with your lab:

https://docs.google.com/document/d/1E2Kg7erfh7sLtNpuzF0u06OHCd1cZGmyncM3ORNSnkQ/edit?usp=sharing (Links to an external site.)

For this lab, you will write up JUST THE FOLLOWING:

Remember you only need 

• Data Table/Observations
• Analysis (graph with best fit lines and equations for lines written underneath the graph)
• Conclusion (claim, evidence and reasoning)

CONCLUSION HINTS

Pre-test for the spring semester

Pre-test today :)

Please do not guess, I want to know what you know, not how good you can guess answers.

Fill out the bubble sheet with your answers, once that is done, please go to 

https://puhsd.d2sc.com/index.html

Your log on and password are your ID#.  Click on Student-at-a-glance (on the left of the screen).  Click on your name, and then assignments.  Your classes should come up on the middle part of the screen, click on assessments under AP Biology, and then take assessment.  You should be able to enter your answers there. Once complete, click save and then submit.

Enzyme Lab

See lab directions for question, materials, procedures and 

sample data table. Here is the lab:

https://docs.google.com/document/d/1E2Kg7erfh7sLtNpuzF0u06OHCd1cZGmyncM3ORNSnkQ/edit?usp=sharing (Links to an external site.)

For this lab, you will write up JUST THE FOLLOWING:

• Data Table/Observations
• Analysis (graph with best fit lines and equations for lines written underneath the graph)
• Conclusion (claim, evidence and reasoning)

CONCLUSION HINTS

Winter Break Assignment

Over the break, please share the newsletter with your parents/guardians (click here for a digital copy).
Also, please share the article "Sloths, Moths and Algae . ." and answer the questions on the back.

Final Review

Click here for a copy of the review.

Make a copy (under the "file" tab) so that you can type directly into the google doc. This is your study guide, the more of it you complete, the easier the final exam will be (it is a week from today)

Peer review

We are going to complete the peer review form electronically.  Here are the steps

1. log into google drive
2. Click here to open the peer review PDF form
3. Once it is opened, at the top of the page, click open with and select "DocHub" (if this is the first time you have used this program, you will have to "OK" it for google drive)
4. The PDF will open in DocHub and you can now add text and fill out the form.
5. One person from your group needs to share your report with another group (Mrs. Strong will assign groups)
6. Once you have completed the peer review form, save it in DocHub and then in the top right corner, there is a button to send it to google drive.  Do that and then share it with the author as well as with me.
7. Once you receive your peer review back, edit the original report and fill out your portion of the peer review, following the same steps for when you edited another group's report. 
8. When your report is complete submit the report to canvas and share the peer review with me (through google drive)

Finish up everything (it is all due by Friday 12/12/14)

There are three BIG assignments to work on (as well as your notebook and anything else not completed)

• Ecology Vocab Slides
• Cell Vocab Slides
• Cell Type Lab

Cell type argumentation write up

Read and summarize a magazine article for the first 5 minutes

Work on your writing of the cell type lab.  We do not have the slides (they went to another teacher to use), so use your previous data.  Your whiteboards are still in the front of the roomCreate a google doc to write your report, use the argumentation board as well as the information below.

Click here for a peer review rubric to help you in the construction of your report.

If you finish your report, then click here for a tutorial on osmosis, answer the questions and e-mail the results to me as well as to yourself.

Finish up Egg lab and discuss cell transport

Summaries go on pg 76

Calculate the percent change in the mass of the egg and volume of the liquid.  
Once that is calculated, create a graph for each set of data (mass and volume)

In what direction did the liquid move each day?  How do you know?  Can you explain what happened?





Background Information: Osmosis is the diffusion of water across a selectively permeable membrane. This means that water can go through membranes from areas where there are a lot of water molecules to areas where there are not so many water molecules.To perform their functions, cells must keep an internal steady state even when the environment outside of the cell is changing. This steady state is called homeostasis. Homeostasis maintained in part by controlling the movement of materials into and out of the cell. To achieve this control, cells are surrounded by a membrane that can tell different substances apart, and can slow down or stop the movement of some substances while allowing others to pass through freely. Because not all substances can go through the cell membrane equally well, the membrane is said to be differentially, or selectively permeable. 
Selectively permeable membranes are those that have openings called pores that let water, oxygen, carbon dioxide and certain other small molecules go through the membrane. 
Cells in the human body need a constant supply of oxygen and water. They are also making carbon dioxide as a waste, and this needs to be removed from the cell. These substances can move into and out of a selectively permeable membrane around a cell through the process of osmosis.

Conclusion questions (use the answers to these questions to help you create a paragraph)
Use these questions to help you write a conclusion paragraph

• When the egg was placed in the water, which direction did the water molecules move? Explain your answer.
• Explain the volume of liquid remaining when the egg was removed from the syrup.
• Why do grocery stores spray their fresh produce with water?
• If a shipwrecked crew drank salt water, they could die. Explain why.
• If a bowl of fresh strawberries is sprinkled with sugar, a few minutes later they will be covered with juice. Explain why this happens.

Egg lab conclusion :)

You should have the mass of the egg recorded on pg 72 (in a table) as well as observations of the egg before and after it is placed into the vinegar, and observations (including mass and volume) of egg after vinegar and before & after for the syrup (mass and volume) and before of water

Day 8 of egg lab –

1. Observe the egg. Record your observations.

2. Carefully remove the egg from the beaker. Be EXTREMELY careful. The egg is very, very fragile now.

3. GENTLY rinse the egg and find its mass. Record.

4. Using a beaker, calculate the mass of the water left in the cup.  Record.  Also, record what they water looks and smells like.

5. throw away the cup

6. pour the water down the drain and clean the beaker

7. place the egg into a ziploc baggie.  You may carefully pop the egg, record any observations you make after it has popped and throw the egg in the garbage.

8. Clean entire lab area

Egg lab again (pgs 72-74) & argumentation session

Summaries for this week go on pg 75


You should have the mass of the egg recorded on pg 72 (in a table) as well as observations of the egg before and after it is placed into the vinegar, and observations (including mass and volume) of egg after vinegar and before syrup

Day 6 of egg lab –

1. Observe the egg. Record your observations.

2. Carefully remove the egg from the beaker. Be EXTREMELY careful. The egg is very, very fragile now.

3. GENTLY rinse the egg and find its mass. Record.

4. Using a beaker, calculate the mass of the syrup left in the cup.  Record.  Also, record what they syrup looks and smells like.

5. Rinse the cup

6. Pour water into the cup up to the 90mL mark (the one from the vinegar)

7. GENTLY place the egg into the water

8. leave the beaker until Wednesday

ARGUMENTATION SESSION

Egg lab (pgs 72-74) & possibly argumentation session

You should have the mass of the egg recorded on pg 72 (in a table) as well as observations of the egg before and after it is placed into the vinegar

Day 3 of egg lab –

1. Observe the egg. Record your observations.

2. Carefully remove the egg from the beaker. Be EXTREMELY careful. The egg is very, very fragile now.

3. GENTLY rinse the egg and find its mass. Record.

4. Using a graduated cylinder, measure the amount of vinegar left in the beaker. Record.

5. Rinse the cup

6. Pour syrup into the cup up to the 90mL mark (the one from the vinegar)

7. GENTLY place the egg into the syrup,

8. leave the beaker until Monday

Argumentation Board

Filling out the whiteboard today :)

Remember the Guiding Question is: 
How should the unknown microscopic organism be classified?

Cell Structure: How should microorganisms be classified? (pgs 68-71)

Summaries for the week go on pg 68

Today we are going to work on a lab to identify the type of cell seen on an unknown slide.

Click here for a template to use for your investigation proposal

Work Day!

After you have read and completed the summary on pg 65, please work on at least one of the following

• Population Biology Virtual Lab
• Ecology Flashcards
• Ecology Quiz

Microscope Lab continued . . .

Summaries still go on pg 65
Continue work on the Microscope lab (pgs 66 & 67)

Intro to Microscope Lab (pgs 65-67)

Summaries go on pg 65 
Here is the PowerPoint we went through before starting the microscope lab. Also, click here for lab, your answers need to go on pgs 66-67

Ebola: The Plague Fighters (pgs 63 & 64)

Today you will watch a Nova special from the Ebola outbreak in the mid 1990's
Please use the video sheet to answer the questions in your notebook on pgs 63 & 64

Continue with the cell

Brief review of the parts of the cell, using cells alive.  Take notes, draw pictures, on pgs 61 & 62

***These drawings should be labeled with the structure and the function of each organelle****

EX: the nucleus is the "brain" of the cell, where the DNA (genetic information) is stored.

Canvas groups and moving to the cell (pgs 60-62)

Summaries for the week on pg 60
Make sure you've signed up for the canvas group for your virtual flashcards for ecology

• log onto Canvas
• Select "people" on the left
• Once it opens, select "groups" on the top
• Join your group :)

Work on the virtual flashcards

Moving onto the cell.

brief review of the parts of the cell, using cells alive.  Take notes, draw pictures, on pgs 61 & 62

Population Biology virtual lab & vocab

Today you will work on 

• Creating a document to turn in for the Virtual Population Biology Lab.  You can either, type up something in a google doc or presentation, or take a picture of your notebook and insert that into a google doc to turn into Canvas.  Please make sure you have all parts of the rubric before submitting the assignment.
• With a partner, go to google drive and create a google slides presentation for vocabulary. Follow the direction in Canvas for what needs to be on each slide and for a list of the required vocab terms.
• There is also an Ecology Quiz on Canvas.  You will have two attempts to get the best score possible.  You may want to work on your vocab slides before you attempt the quiz.

Vaccines and population information (pgs 59-60)

Summaries for this week go on pg 59

We are going to watch a nova special on vaccinations.  Think about populations and how more populated areas might be affected more (density dependent vs density independent factors).

If time allows, discuss exponential and logistic growth as well as virtual lab.   

Population Biology Virtual Lab pgs 57-58

Click here for the link to the population biology virtual lab.  Use pgs 57-58 to take notes on your lab and results.

Finish "Farming in the Rye" and start population graphs pgs 54-56

Summaries for this week go on pg 54

Eternal Enemies and food web discussion and whiteboarding activity. (Can you make a food web from what you saw in the video?)

Finish up the Farming in the rye activity on pg 53 of your notebook.

Then using the textbook again, go to pg 123 in the text book and follow the directions in the "Analyzing Data" section for making both an exponential and logistic graph (rabbits and fruit fly populations).  

This information will go on pgs 55 & 56 of your notebook.

Eternal Enemies Video pg 48

Continue watching the Eternal Enemies Video and continue your notes on pg 48 (remember you are taking notes about the interactions between the organisms)

We will discuss on Monday and create a food web from the data you collect.

Nutrient Cycles & Farming in the Rye pgs 52 & 53

Go through the following tutorial on the nitrogen cycle
Click here

Take notes on pg 52

On pg 53, copy the following data table and answer the questions

Graph for Hawk, Rabbit, Grass pg 51

Finish up your graph for Hawk Rabbit Grass.  Remember to reference the rubric so that you have all of the needed parts of the graph :)

Hawk, Rabbit, Grass (and the plant lab too) pgs 49-52

Welcome back!

Quick review of ecological stuff and then on to cells.

Summaries for this week go on pg 49

Hawk Rabbit Grass lab (see slides below) on pgs 50-52

Mid-term

Agenda for today

Go to D2SC

• Log on (use your ID twice)
• click on "Student at a glance" on the left of the screen, then click on your name and assignments.

Log onto Canvas

• go to assignments 
• click on the mid-term
• Follow the directions there

Eternal Enemies

While watching Eternal Enemies (you can look on youtube if you missed any part). Think of the food web you could create for the animals and plants that you see.  Take notes on pg 48 and then when it is finished we will create a food web on pg 49.

Remember Mid-term test tomorrow!  

Transplant beans, pond & midterm study guide

Agenda for today:

1. Transplant beans to larger cup -- what observations can you make?
2. trip to the pond -- Observations on pg 47
3. Mid-term study guide -- make a copy on your google drive, so that you can edit it and takes notes, make a plan, etc. . .Test is on Thursday

Ecosystem Ecology

Today we are going to watch a brief video on Ecosystem Ecology.
Why do we care about all of these interactions?
Use the information learned in the video to help you answer the questions in your notebook on pgs 41-45

pgs 41 & 42

We discussed the information on pgs 41 & 42
Components of an ecosystem & food chains.  Make sure you have marked up the text on those pages as well as answered all of the questions.

Bean Dissection and Ecology info (pgs 37-45)

What is in a bean?

Agenda
Reading Science World -- weekly summaries on pg 37

pg 38 -- Bean dissection observations and drawings (try to label them using info on pg 39)
pg 39 -- Seed Structure & Germination
pg 40 -- Events in Germination
pg 41 -- Components of an Ecosystem
pg 42 -- Food Chains 
pg 43 -- Energy Inputs and Outputs
pg 44 -- Food Webs
pg 45 -- Food webs continued . . .

M&M lab and CER conclusion for Mystery due today

There are two assignments that should be submitted on canvas today.

• M&M Lab
• Mr. Xavier Mystery -- Claim, Evidence, Reasoning conclusion

Remember to submit your assignment on canvas

• Go to Google Drive
• Select your document & click on share (top right hand corner of the screen)

• Then click on "get shareable link" and copy the link (if you have a different version, it may say private, click there and then change it to "anyone with a link")

• Go to Canvas, click on assignment and submit then,
• Paste the link into canvas

Intro to Energy (pgs 33-35)

Question
What is energy?

Agenda
Read current science and write summary on pg 33
Burning a peanut

1. Put on googles and leave them on until the end of the lab.
2. Double check that there is 100 mL of water in your 250mL beaker (with a graduated cylinder)
3. Place beaker on wire stand
4. Take initial temperature and record
5. Weigh your peanut and record the mass
6. Careully make a stand with a paperclip and place it inside the jar lid.
7. Place the peanut on the paperclip
8. Once it is stable, let the teacher know you are ready to light your peanut.
9. Once the peanut is lit, start your stopwatch and measure & record the temperature every 30 seconds.
10. When the peanut burns, let it cool and then weigh and record the mass again.
11. Pour the water into a graduated cylinder to measure the amount left.

   Record your information in a data table.  

   Analysis

Create a line graph of the temperature changes. Also, compare information with another table

Energy of a peanut	Your trial	Another groups trial
Mass of peanut (g)
Mass of remaining material (g)
Calculate mass burned (g)
Volume of liquid water (beginning)	100 mL	100 mL
Volume of water after heated

Qualitative observations

Describe how the peanut burned

How did the peanut look after it burned?

Compare the mass of the peanut before and after burning it.  Explain what happened.  Tell where the mass went.

Compare your trial results with that of other groups.  Discuss how are they similar and how are they different.  Give reasons for each.

Claim Evidence Reasoning (Canvas Submission)

All of the following information can also be found on Canvas.   Your job is to write a CER (claim, evidence, reasoning) conclusion based on the information gathered around Mr. Xavier's murder.  The question you are answering, is "What really happened to Mr. Xavier?" Please make sure that you reference which scenario you used for the additional information.


More Practice

Pick one of the following links for additional information to help in your claim

Scenario 1

Scenario 2

Scenario 3

Characteristics of life (pgs 31 & 32)

Question for the day
What are the characteristics of life?

Agenda
Get a Science world and read for 5 minutes, summary continuing on pg 29
In the last quadrant from the "Alive or not alive" activity,list all of the things you think makes something alive.  Also brainstorm with your group and write on the whiteboards on your table

As we discuss and come to a consensus about the characteristics of life, write the finished list in the tiger and tape it into your notebook on pg 32
On that page, also write

• 3 things you learned today
• 1 question you still have about characteristics of life

Alive or not alive? (pg 30)

Question for the day
What characteristics make something alive?

Agenda
Read Science World -- summary on pg 29 for this week

on pgs 30-31 -- split the pages into 8 parts (basically make quadrants on the two sides).  
In each square you should have 

• Minimum of 5 observations of the object at the station
• Answer to the question "Is it alive or not alive?"
• Justification for your answer

Work Day

Read for 5 minutes (summary on pg 26)
Continue to work on your M&M lab and/or anything else that needs to be completed :)

Getting Started on Canvas & Making a graph on Google Drive

Canvas is the platform that we will use to turn in some assignments throughout the school year.
Please write the following website on the inside front cover of your notebook

canvas.instructure.com

Check you gmail account.  There should be an invitation to join a class from canvas (it might just say notifications in the "from" field).  Click on the link on the bottom of the e-mail (see the picture below -- it might say "click here to get started" instead of "click here to view the course page")

Then follow the directions to create a canvas account.  If you are worried that you will forget your password, please write down your e-mail and password in your notebook as well.

Continue working on your lab report for the M&M lab.  
Click here for a tutorial on how to insert a graph into google docs.

Share your contact information

M&M lab (pgs 27-29)

Agenda

• Read Science World -- summary on pg 26
• Click here for the lab for today (Do M&M's packages contain the expected amount of colors?)
• Remember for this lab, you need to make sure you have
• Hypothesis
• Data table
• Graph
• Conclusion

Work Day

Using the rubric from the back of your notebook, go through all previous assignments and edit as needed. Notebook check next week! :)

Identifying variables (pgs 24-25)

Do distractions affect how quickly something is done?
We are going to do an activity today to determine if distractions affect how quickly you can complete something. 
The only thing that goes in your notebook will be the graph you create as well as a conclusion paragraph following the rubric in the back of the book.

Check Lab Continued . . . (pgs 20-22)

Finish up the check lab for today.
But first, read from Science World and write your summary on pg 23.
Click here for the questions to answer on pgs 20-22.
Click here for a you tube video that helps to explain the difference between a theory and a hypothesis.

Block Day Checks Lab (pgs. 20-21)

Today you will complete the "checks" lab pgs. 20-21.  

When do you have enough evidence to form a valid, logical conclusion?

Follow the directions on the pink sheet.  A simplified version is below

 Work in groups of 3 or 4.....
* Keep the 'checks' (evidence) hidden in the envelope.....
* Pull out ONLY 3 checks, and discuss with your group what situation the checks imply
* Record the implied scenario (both on a whiteboard and in your notebook).....
*Now, pull 3 more checks and modify the scenario (again, add information to your whiteboard as well as your notebook)........
* Now, pull 3 more checks and further modify the scenario(again, add information to your whiteboard as well as your notebook).......
* Publish your results by describing your analysis to the group

Make sure you answer the questions on the back side of the pink sheet in your notebook (use the "science is. . ." article on pg 12)

Friday -- Challenges of Life video

Watch the episode "Challenges of Life" from the LIFE series.  Please take notes on page 19. 

Review of Scientific Method and Process

Question to answer for the day:
Is there only one scientific method? Why or why not?

Agenda:

• Read Science World and summarize on pg 13
• Watch the video from education portal.  Click here to watch again, or if you missed it.
• Go back and check notebook for scores on SSA, fill it out and work on fixing scores as needed.

Late Start Day

Objective for today

• I can understand what is required for a notebook check in Biology class

5 minute reading (with summary on pg 13)
Go over SSA for scientific method & inquiry
Get notebook ready for check

Oobleck Lab (pgs 14-17)

Objectives for today:
I can
 Differentiate between qualitative and quantitative data.
 Make quantitative data measurements.

 Practice appropriate lab procedures.

INTRODUCTION:
This week we are learning about the nature of science and scientific inquiry. It is important to think like a scientist. Scientists use a set of skills to answer questions and test ideas about the natural world.
Scientists must be objective in their observations and analysis of their data. Scientists often use quantitative data, data that can be measured, in order to analyze their results objectively.

Today we are going to complete an activity in making Oobleck and see if we can determine what type of substance it is and practice making both qualitative & quantitative measurements and the process of the scientific method.
Click here for an extra copy of the inforamation.

pg 12 "Science is . . ." article Mark the Text

Today you should be able to answer the question:

"What is Science?" and also understand how the literacy strategy of Marking the Text increases your comprehension of material.

Start with reading the Spider Man issue of Science News.  Summary on pg 7 again
Today we are going to read the article "Science is . . ."
We are going to use the literacy strategy of Marking the Text to gain information from the article.
The directions for that, go in the back of your notebook, as well as the SSA for the Scientific Method Unit.

Continuation of Surface Tension Lab

5 minutes to read an article in Science World (summary on pg 7 again)

Remember, that by the end of the lab, you should be able to answer the following question


How is the surface tension of water affected by soap?

Continue with the lab from yesterday.

pgs 10-11 Surface Tension/Penny lab

Today we are working on a lab to answer the question:
How is the surface tension of water affected by soap?

Use pgs 10-11 to record all of your information for the lab.